Superpetroleros: primer triunfo del Audi R10 TDi

Tema en 'Foro General BMW' iniciado por srclooney, 23 Mar 2006.

  1. srclooney

    srclooney Forista

    11 Oct 2004
    Me Gusta:
    Tom Kristensen, Rinaldo Capello y Allan McNish han logrado la victoria en las 12 horas de Sebring, primera prueba de la ALMS (Amercian Le Mans Series). Hasta ahí todo normal, sino fuera por que el coche nº 2 que pilotaban era un Audi R10 Tdi; sí, un Diesel V12 de 5,5 litros construido en aluminio que rinde 650 caballos.
    Aunque habían logrado la pole, en los entrenamientos oficiales, Capello tuvo que tomar la salida desde el pit lane, al haber sustituido un intercooler tras el warm-up. Sin embargo a las dos horas el R10 TDi ya estaba en cabeza junto a sus compañeros de equipo Werner, Biella y Pirro, que con el R10 nº 1 se vieron forzados a abandonar en la cuarta hora de la carrera, con problemas de sobrecalentamiento del motor.
    La proxima cita del R10 TDi será aún más importante para Audi: las 24 horas de Le Mans, del 17 al 18 de junio próximos. La mitica prueba francesa es el gran objetivo de la marca alemana.


    Fuente revista coche actual.
  2. ESKY34

    ESKY34 Baneado Baneado

    23 Oct 2005
    Me Gusta:
    eso tiene tanto de petrolero como yo de guapo:descojon: :descojon: :descojon: :descojon:
  3. Joe vespino

    Joe vespino Guest

    que se preparen a oir el tacatacatacatacataca en los boxes :)
  4. Prodar

    Prodar Forista

    26 Jul 2005
    Me Gusta:
    Donde sea
    JAJAJAJ joe de tacatacataca nada y mas con las revoluciones q puede llevar eso incluso en ralenti .
    Me parece que aqui mismo en Bmwfaq se puso el video de la presentacion der bisho ese en paris bajo la torre eifel Y jooooooder como sonaba eso Si no es por que el tio dice muchas veces en el video q el coche es diesel ne creo que las pegatas son simplemente publicidad de los tdis vag
    Suena a turbina de avion y de tacataca nasty de plasty
    lo reconozco y yo amo el sonido 6l gasofa de bmw
  5. srclooney

    srclooney Forista

    11 Oct 2004
    Me Gusta:
    En fin os dejo me voy a la camita, lo puse pensando que era repost ;)
    Es una gran noticia, ya que el diesel como que no... en el mundo de la competicion, esto demuestra que si que es posible el que un calamar este a la altura de los grandes gaysolinas (ya escribo casi como vosotros ;) )


    ATEMPS Guest

    Que desgracia, imaginar como salga bien el tema 12 de esos dando vueltas al circuito.... !!!! la virgen que peste tiene que hacer!!!! :)
  7. arodpon

    arodpon Forista Senior

    23 Dic 2005
    Me Gusta:
    Gran Canaria
    ¿Y del efecto calamar qué?, seguro que no lo pueden adelantar de la tinta que va dejando atrás.
  8. Gus

    Gus Tali-bahn Staff BMW FAQ Coordinador Miembro del Club

    28 Ene 2002
    Me Gusta:
    A 1800 kms del Ring
    Pues si no da problemas de fiabilidad, todas esas pruebas largas se la va a llevar de calle... para a repostar no recuerdo si un 30 o un 40% menos de veces y en Le Mans piensan hacer del orden de 3 o 4 vueltas más con el mismo depósito con respecto al ya victorioso R8 FSI...así ya le puedes arañar décimas (si es que es el caso) en cualquier curva...luego se hace Les Hinaudieres a la misma velocidad y con un consumo muy inferior (o sea, igualito que en la calle ;-))
  9. Pellus

    Pellus Forista Senior Miembro del Club

    1 Dic 2004
    Me Gusta:
    Cider Town - Gipuzkoa
    330d / 130i
    Adelante, con los "calamar" power. :) :)
    Eso, solo es el inicio, esperar a verlos rodar en el Jarama el 26 de Agosto. :flip:

    Mordereis el polvo, gasofillas:flip::)
  10. Alfa156

    Alfa156 Downsized Staff BMW FAQ Coordinador Miembro del Club

    20 Oct 2004
    Me Gusta:
    Catacumbas del foro
    Flat Six
    Para carreras de este tipo, donde prima la regularidad, el arma definitiva.

    Me ha chocado que les hubiera petado un intercooler, no? si hubiera sido un turbito o cauda, pues hubiera dicho: "mira como en BMW" :finga:
  11. arodpon

    arodpon Forista Senior

    23 Dic 2005
    Me Gusta:
    Gran Canaria
    En estos, ¿no fallaría un inyector-bomba?, je,je,...
  12. Furius

    Furius Guest

    La de excusas que se inventan los defensores de la caduca gasolina para justificarse... deberiáis veros " que si echa humo y no deja ver, que si hace ruido, que si falla el caudalímetro " pues nada de eso ha ocurrido ( es lo único que queda para justificar lo injustificable, ¿qué problema hay en rendirse a la evidencia de que el diesel es el motor del futuro porque está en continua innovación y los motores de gasolina hace tiempo que están estancados ? )
  13. davidW

    davidW Mozo Staff BMW FAQ Moderador Miembro del Club

    14 Oct 2002
    Me Gusta:
    Hell´s kitchen
    el R10 será un V10...digo yo
  14. Gus

    Gus Tali-bahn Staff BMW FAQ Coordinador Miembro del Club

    28 Ene 2002
    Me Gusta:
    A 1800 kms del Ring
    Furrius, tranqui, que lo leo y es broma, hombre :D

    El motivo para lo que dices al final es que es mentira o al toda la verdad ;-)
  15. vwgticooper

    vwgticooper Guest

    No es tan raro ver motores "calamardos" en competicion, uno de los Dragter´s mas potentes lleva motor Cummis que es como los legendarios Barreiros
  16. ATEMPS

    ATEMPS Guest

    Eso es mas bien una apreciación tuya particular :roll: pero eso de que es el motor del futuro esta por ver.

    Para otros mas bien es una moda del d que para nada tiene que ser un deseo real de los compradores.

    En cuanto a la innovación pues avanzan igual o mas que los diesel que por ir tan apretaditos para poder compararse en prestaciones con los gasolina no paran de petar y perder cada vez mas fiabilidad..... pero tranquilos que en los próximo objetivos de las marcas esta un 20% menos de consumo en gasofa y introducción de turbos a los gasolinillas, entonces veremos :)

    Por cierto siempre e dicho que no es una cosa mejor que otra, si no motores totalmente diferentes que la gente se empeña en comparar cuando no tiene sentido pero bueno demos mas vueltas de tuerca a la cosa.;-)
  17. Furius

    Furius Guest

    Hace 20 años los motores de gasolina se merendaban a los diesel en todo, hace 10 la cosa se comenzó a ver igualada con los TDI bomba inyección de VGA y ahora el D arrasa allá por donde va... son evidencias, amigos ;)
  18. Cocreta

    Cocreta Moderador X Staff BMW FAQ Moderador Miembro del Club

    9 Feb 2005
    Me Gusta:
    Cocreta's World
    Absolutamente de acuerdo.

    Si mal no recuerdo, el problema que tuvieron no es que fallase el intercooler, sino que se obstruyó con trozos de goma que se quedaron pegados. El tema es que tuvieron un problema con la telemetría y no se dieron cuenta de la obstrucción hasta que no paró en boxes a repostar. Ahí vieron que el coche podía llevar bastante tiempo con ese problema y, antes de provocar una avería mayor, decidieron retirarse.

    Lo que no recuerdo es dónde he leído esto antes... :) :D
  19. Gus

    Gus Tali-bahn Staff BMW FAQ Coordinador Miembro del Club

    28 Ene 2002
    Me Gusta:
    A 1800 kms del Ring
    Furius, que 6 turbodiesel anteriores me contemplan (ID, II, TGV, TFijo, 6L, 4L, hasta con motores con 4 culatines ...): lo que quiero decirte es que eso... es obvio (el avance, tambien en petamientos).

    Pero el futuro no lo tengo la claro, incluso prescindiendo de que las normas anticontaminantes ya les están suponiendo un freno: el futuro inmediato -pienso- pasa en una primera fase por motores híbridos de cilindradas contenidas, gasolina o diesel - con ventaja para los gasolina por simplicidad, coordinación con el motor de apoyo y coste de producción- y a medio plazo (15/20 años) apenas con combustibles del origen de los habrá caso.

    Un estupendo forero hace años escribió un post que el tiempo veo que va ratificando : se titulaba "El futuro quizá sea diesel...pero no gasoil" :D
  20. Joe vespino

    Joe vespino Guest

    La caduca gasolina dice :descojon: :descojon: :descojon:

    Esssse furius ;-)
  21. srclooney

    srclooney Forista

    11 Oct 2004
    Me Gusta:
    Y a todo esto no seria descabellado ver un diesel en formula uno... jejeje... si hacen mas kilometros con el mismo deposito y no necesitan respostar tanto lo mismo es interesante en un futuro. Ademas la cifra de 650 cv esta muy proxima a los 700 que mas o menos rinden los f1
  22. Cocreta

    Cocreta Moderador X Staff BMW FAQ Moderador Miembro del Club

    9 Feb 2005
    Me Gusta:
    Cocreta's World
    Ya, la diferencia es que los F1 de gasofa no llevan un "5 litros" turbo :)
  23. ATEMPS

    ATEMPS Guest

    No pero tranquilo que de aquí a 20 años mas y con 6 turbitos bien apretaditos podrán reducir el cubicaje y conseguir el caballaje, lo malo es que para entonces se caducara la gasolina :descojon: si pero tambien se termira el petroleo :)
  24. Joe vespino

    Joe vespino Guest

    Pero los F1 tampoco se tiran 12 o 24 horas rodando, si te venden un 535d AC Snitzher de esos con 3 litros t 310 caballos "para la calle" (o sea, que se espera rodar 200.000 o 300.000 kms con él) no creo que haya mayor problema en sacar motores de competición similares con 700 caballos.

    Si todos estamos de acuerdo en que el rendimiento energetico del gasoil es mayor ¿porque no utilizarlo en la F1?que ya me pierdo es lo de la limitación de régimen de giro de los diesel por las inercias que son capaces de soportar sus piezas moviles, que se hasta que punto con materiales estratosfericos eso se puede solucionar :)
  25. ATEMPS

    ATEMPS Guest

    Lo dicho Joe, de aqui 20 añitos tal vez si, pero sin petroleo ni F1 ni na de na :) todos con hibridos y motorcitos electricos ;-)
  26. Gus

    Gus Tali-bahn Staff BMW FAQ Coordinador Miembro del Club

    28 Ene 2002
    Me Gusta:
    A 1800 kms del Ring
    Tu lo has dicho Joe...materiales estratosféricos podrían solucionar las pegas -creo que no todas: en F1 las diferencias son de segundos o décimas , cuando no de centésimas para la pole, frente a las en ocasiones horas completas en pruebas de resistencia....y eso implica una mucha mayor posibilidad de dosificación de la potencia -regímenes, lo único no solucionable- ...pero aún así ...el coste sería justificado para algo que hace mejor y más simplemente la gasolina?

    Siempre ha habido esprinters y gregarios, o velocistas y maratonianos: está claro que a base de doping estratosféricos (es un símil) el maratoniano podría reconvertirse :D El tema es si merece la pena, realmente.
  27. ATEMPS

    ATEMPS Guest

    Esta claro que para la F1 es incuestionable y estamos haciendo demagogia, pero lo que es innegable es que dentro de poco los petroleros empezaran a entrar en competiciones ( aunque sea entre ellos ) pues la competitividad entre marcas echan en falta ese "algo mas" ....

Compartir esta página